ID: 1007256592_1007256598

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1007256592 1007256598
Species Human (GRCh38) Human (GRCh38)
Location 6:40534025-40534047 6:40534073-40534095
Sequence CCTTCCACTTTCTACATGAGAAA CTTGCCCACAGGGACACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 385} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!