ID: 1007323882_1007323895

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1007323882 1007323895
Species Human (GRCh38) Human (GRCh38)
Location 6:41045843-41045865 6:41045880-41045902
Sequence CCCCTCCTCCACCAAGGGCATGC CAGGTCACAGGCACCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 924, 4: 3236} {0: 1, 1: 0, 2: 2, 3: 24, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!