ID: 1007326172_1007326176

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1007326172 1007326176
Species Human (GRCh38) Human (GRCh38)
Location 6:41061674-41061696 6:41061692-41061714
Sequence CCGGAGATCCAGGCTGCTCTGAA CTGAAGAAGCTGAAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 509} {0: 1, 1: 0, 2: 6, 3: 69, 4: 602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!