ID: 1007356081_1007356093

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1007356081 1007356093
Species Human (GRCh38) Human (GRCh38)
Location 6:41318846-41318868 6:41318887-41318909
Sequence CCCAGCCCAGCACTCCTTCCACT GAGGACAGGAAGCAGAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 527} {0: 1, 1: 0, 2: 5, 3: 69, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!