ID: 1007406034_1007406046

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1007406034 1007406046
Species Human (GRCh38) Human (GRCh38)
Location 6:41637042-41637064 6:41637087-41637109
Sequence CCGGACAGCAGCCGGATCCCGGC GACCCCCGCGGCTAGCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!