ID: 1007407588_1007407597

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1007407588 1007407597
Species Human (GRCh38) Human (GRCh38)
Location 6:41643928-41643950 6:41643955-41643977
Sequence CCTGTGGGAGAGTCAGGTCCCCC CAGGGCCCAGGGCCATAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133} {0: 1, 1: 0, 2: 4, 3: 59, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!