ID: 1007420039_1007420041

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1007420039 1007420041
Species Human (GRCh38) Human (GRCh38)
Location 6:41713701-41713723 6:41713720-41713742
Sequence CCTTTGCATGAATCATTTTCTAT CTATTCTCCCCAGAGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 417} {0: 1, 1: 1, 2: 0, 3: 27, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!