ID: 1007431426_1007431449

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1007431426 1007431449
Species Human (GRCh38) Human (GRCh38)
Location 6:41779662-41779684 6:41779704-41779726
Sequence CCCCGGATCCCCGCCCCCAGCCC CGCCCGCCCGGGGCTTCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 127, 4: 1197} {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!