ID: 1007461988_1007461993

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1007461988 1007461993
Species Human (GRCh38) Human (GRCh38)
Location 6:42025706-42025728 6:42025736-42025758
Sequence CCTTTTGGGCTCTGAGTCACAAG CTCTCAGAGCTGTGATGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 142} {0: 1, 1: 0, 2: 2, 3: 14, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!