ID: 1007498568_1007498574

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007498568 1007498574
Species Human (GRCh38) Human (GRCh38)
Location 6:42278946-42278968 6:42278981-42279003
Sequence CCTTTACAGTCTTTTATACCAAC CCTTCTATGCCAGGGCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 163} {0: 1, 1: 0, 2: 2, 3: 22, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!