ID: 1007544727_1007544733

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1007544727 1007544733
Species Human (GRCh38) Human (GRCh38)
Location 6:42684900-42684922 6:42684942-42684964
Sequence CCCTGCCACTGGAAACACCTCTC TTTGTTGTTGTTCTTTGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 182} {0: 1, 1: 14, 2: 99, 3: 587, 4: 3799}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!