ID: 1007581158_1007581171

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1007581158 1007581171
Species Human (GRCh38) Human (GRCh38)
Location 6:42960929-42960951 6:42960975-42960997
Sequence CCAGCACGGCTGCCAGCGGGTGC TGAGCCCAGGCCGGGGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129} {0: 1, 1: 0, 2: 4, 3: 100, 4: 906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!