ID: 1007582432_1007582438

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1007582432 1007582438
Species Human (GRCh38) Human (GRCh38)
Location 6:42967455-42967477 6:42967496-42967518
Sequence CCCCTCTGACAGAGCAGGCACCT CTGTCTGCACATCAGCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 256} {0: 1, 1: 0, 2: 0, 3: 16, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!