ID: 1007607163_1007607172

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1007607163 1007607172
Species Human (GRCh38) Human (GRCh38)
Location 6:43125378-43125400 6:43125393-43125415
Sequence CCCAGCCCCAGGAGTGGGTGCTG GGGTGCTGGAGGCTGAGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 135, 4: 829}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!