ID: 1007621128_1007621139

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1007621128 1007621139
Species Human (GRCh38) Human (GRCh38)
Location 6:43215289-43215311 6:43215340-43215362
Sequence CCTTTCTGTGGCAGCCAGAGCGA CTGACCCCTTGCAGTGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169} {0: 1, 1: 0, 2: 3, 3: 16, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!