ID: 1007631243_1007631258

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1007631243 1007631258
Species Human (GRCh38) Human (GRCh38)
Location 6:43274807-43274829 6:43274857-43274879
Sequence CCACACACCATCCAGTGGGCGTC GCCCGCTTCCTCCAAATGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!