ID: 1007631417_1007631426

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007631417 1007631426
Species Human (GRCh38) Human (GRCh38)
Location 6:43275384-43275406 6:43275419-43275441
Sequence CCGTTTTCGTTTGCTTTTCCCTG GGCCTTTGGGTCCCTGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 669} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!