ID: 1007631422_1007631432

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1007631422 1007631432
Species Human (GRCh38) Human (GRCh38)
Location 6:43275403-43275425 6:43275426-43275448
Sequence CCTGCTGCTGGCTGGCGGCCTTT GGGTCCCTGGCCCCGGGGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 43, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!