ID: 1007631474_1007631494

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1007631474 1007631494
Species Human (GRCh38) Human (GRCh38)
Location 6:43275557-43275579 6:43275605-43275627
Sequence CCTGACTCCCGTTACCTCACTGC CCAATAATTGGCCTTGCAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109} {0: 1, 1: 0, 2: 0, 3: 2, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!