ID: 1007637641_1007637647

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1007637641 1007637647
Species Human (GRCh38) Human (GRCh38)
Location 6:43308729-43308751 6:43308747-43308769
Sequence CCTCCGCAGCCCGGGCCTCACCG CACCGAAGAAAACAGGTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 534} {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!