ID: 1007662183_1007662190

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1007662183 1007662190
Species Human (GRCh38) Human (GRCh38)
Location 6:43493609-43493631 6:43493654-43493676
Sequence CCTTTCCTCTTCTGCATCTCTGA ACCCCGGAAAGGATGGCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!