ID: 1007739179_1007739187

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007739179 1007739187
Species Human (GRCh38) Human (GRCh38)
Location 6:44000684-44000706 6:44000719-44000741
Sequence CCTGCATTCTGCGGAGGGTGAGA CAGTCAAAGGAGAAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 157} {0: 1, 1: 0, 2: 4, 3: 51, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!