ID: 1007790827_1007790837

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1007790827 1007790837
Species Human (GRCh38) Human (GRCh38)
Location 6:44307196-44307218 6:44307228-44307250
Sequence CCACCTGAGACCCCCAGCAGCCC CTGTAGCCCTTCCAGACTCACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 41, 4: 458} {0: 1, 1: 0, 2: 0, 3: 29, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!