ID: 1007909073_1007909078

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1007909073 1007909078
Species Human (GRCh38) Human (GRCh38)
Location 6:45495041-45495063 6:45495057-45495079
Sequence CCACCCATCCTCCAAGGCCACTG GCCACTGTGTTATCTTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 378} {0: 1, 1: 0, 2: 0, 3: 18, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!