ID: 1007966005_1007966011

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1007966005 1007966011
Species Human (GRCh38) Human (GRCh38)
Location 6:46004333-46004355 6:46004362-46004384
Sequence CCAGCTTCCCTTGCACAGAGGAA CAGGATTGAGCTCTGGACTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!