ID: 1007968805_1007968812

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1007968805 1007968812
Species Human (GRCh38) Human (GRCh38)
Location 6:46029869-46029891 6:46029921-46029943
Sequence CCCTGCTCCTGTTAGGGATTAAA TTCCAGATCTGCAGTTGTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!