ID: 1008027475_1008027480

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1008027475 1008027480
Species Human (GRCh38) Human (GRCh38)
Location 6:46653888-46653910 6:46653934-46653956
Sequence CCTACAATACCAGGGACTGTGGA CTGACCTTCTTACAGGCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!