ID: 1008030405_1008030416

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1008030405 1008030416
Species Human (GRCh38) Human (GRCh38)
Location 6:46688156-46688178 6:46688205-46688227
Sequence CCGGGGGCCTCGCTGGCCCTGCG ATGTGATCCCGGTGCAGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 490} {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!