ID: 1008052751_1008052753

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1008052751 1008052753
Species Human (GRCh38) Human (GRCh38)
Location 6:46916482-46916504 6:46916497-46916519
Sequence CCTGCTGCTGATGTGCTCAGAGC CTCAGAGCCCCTCATCGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207} {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!