ID: 1008092842_1008092852

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1008092842 1008092852
Species Human (GRCh38) Human (GRCh38)
Location 6:47309707-47309729 6:47309744-47309766
Sequence CCAGCGGCGCGGCCGCCCAGGCG CGACTGCAGCCCGCGTCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 257} {0: 1, 1: 0, 2: 0, 3: 18, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!