|
Left Crispr |
Right Crispr |
| Crispr ID |
1008130235 |
1008130243 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:47712939-47712961
|
6:47712969-47712991
|
| Sequence |
CCGGGCTGTGGCCTCTTAGGATC |
CACAGCAGGAGGTGAGCGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 14, 3: 256, 4: 584} |
{0: 12, 1: 226, 2: 1169, 3: 1438, 4: 1278} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|