ID: 1008130235_1008130244

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1008130235 1008130244
Species Human (GRCh38) Human (GRCh38)
Location 6:47712939-47712961 6:47712990-47713012
Sequence CCGGGCTGTGGCCTCTTAGGATC GGTGAGCGAACATTATCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 256, 4: 584} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!