ID: 1008481688_1008481691

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1008481688 1008481691
Species Human (GRCh38) Human (GRCh38)
Location 6:51992849-51992871 6:51992874-51992896
Sequence CCAGCTCTGGGTTAAGAAGGTAC CCTTCAGTATTGCTGGTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85} {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!