ID: 1008508714_1008508720

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1008508714 1008508720
Species Human (GRCh38) Human (GRCh38)
Location 6:52256208-52256230 6:52256230-52256252
Sequence CCCAAAACCATCTGCTCTCCAGC CCCCACATTCACCCTTGGACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!