ID: 1008648901_1008648908

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1008648901 1008648908
Species Human (GRCh38) Human (GRCh38)
Location 6:53544360-53544382 6:53544380-53544402
Sequence CCGGGAGGCGCTCGAGGACCCCC CCCGGGCGCAGTGGAGAACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 139} {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!