ID: 1008865482_1008865487

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1008865482 1008865487
Species Human (GRCh38) Human (GRCh38)
Location 6:56204646-56204668 6:56204664-56204686
Sequence CCTCCACAGTGGGTCCCTGACCC GACCCCCGTGTATCCTGACTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 7, 3: 108, 4: 402} {0: 42, 1: 184, 2: 504, 3: 1717, 4: 3858}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!