ID: 1008969583_1008969586

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1008969583 1008969586
Species Human (GRCh38) Human (GRCh38)
Location 6:57351453-57351475 6:57351494-57351516
Sequence CCAAATGAAGGACTGAATGAGGA CTGTGAGAATGGAAAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 258} {0: 2, 1: 0, 2: 7, 3: 245, 4: 3964}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!