ID: 1008985927_1008985936

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1008985927 1008985936
Species Human (GRCh38) Human (GRCh38)
Location 6:57543023-57543045 6:57543053-57543075
Sequence CCGCCCCCTGGGCTTCACGCCAT CCTCAGCCTCCCGAGTAGCTGGG
Strand - +
Off-target summary No data {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!