ID: 1009023221_1009023231

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1009023221 1009023231
Species Human (GRCh38) Human (GRCh38)
Location 6:57967872-57967894 6:57967919-57967941
Sequence CCCACGATGTTCTTGAGGGGCCC TTGGTGTTACCATATTTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!