ID: 1009308634_1009308641

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1009308634 1009308641
Species Human (GRCh38) Human (GRCh38)
Location 6:62122274-62122296 6:62122313-62122335
Sequence CCTGCCATCTTCTGCAGATAACC GCACCTCTTGGCTTGTTATCGGG
Strand - +
Off-target summary {0: 10, 1: 193, 2: 189, 3: 116, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!