ID: 1009392613_1009392619

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1009392613 1009392619
Species Human (GRCh38) Human (GRCh38)
Location 6:63163369-63163391 6:63163394-63163416
Sequence CCTTCTTCGGTCTCCCTCTGTTG GAGGCTGGACTGTACTGCCGTGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 8, 3: 113, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!