ID: 1009404896_1009404905

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1009404896 1009404905
Species Human (GRCh38) Human (GRCh38)
Location 6:63300139-63300161 6:63300162-63300184
Sequence CCTTCCTCCTCCAGCTTTGCCTG CTGGCCATGCTGAGAGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 82, 4: 663} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!