ID: 1009474925_1009474927

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1009474925 1009474927
Species Human (GRCh38) Human (GRCh38)
Location 6:64078779-64078801 6:64078818-64078840
Sequence CCTATGGCACTATCATCAGCTTG GATTAAAGTACGAACTTTAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!