ID: 1009504770_1009504777

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1009504770 1009504777
Species Human (GRCh38) Human (GRCh38)
Location 6:64463097-64463119 6:64463123-64463145
Sequence CCACCACGCCCGGCTATTTATTT GGATTTTTTTACTAGAGATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 11, 2: 996, 3: 3609, 4: 20704}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!