ID: 1009524996_1009524999

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1009524996 1009524999
Species Human (GRCh38) Human (GRCh38)
Location 6:64732600-64732622 6:64732619-64732641
Sequence CCTAGTGGCGTATAGTAAAATTG ATTGTAGGCATAAGGATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50} {0: 1, 1: 0, 2: 0, 3: 13, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!