ID: 1009820823_1009820829

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1009820823 1009820829
Species Human (GRCh38) Human (GRCh38)
Location 6:68798853-68798875 6:68798901-68798923
Sequence CCGTGGATCTCCCAGAAAAGCTG CTTCACGAGTGAAAGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 253} {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!