ID: 1009846964_1009846972

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1009846964 1009846972
Species Human (GRCh38) Human (GRCh38)
Location 6:69146277-69146299 6:69146324-69146346
Sequence CCAGGTTGTGACAGTGCCCAGGC CAGAGTGAGCACTGGGAATGGGG
Strand - +
Off-target summary {0: 4, 1: 19, 2: 37, 3: 95, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!