ID: 1009847456_1009847471

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1009847456 1009847471
Species Human (GRCh38) Human (GRCh38)
Location 6:69151400-69151422 6:69151453-69151475
Sequence CCCACAATCACTGTGCTCCCCCA TGGTTGCTGCTGGAGAATGGGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 25, 3: 77, 4: 325} {0: 1, 1: 1, 2: 5, 3: 49, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!