ID: 1009915534_1009915543

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1009915534 1009915543
Species Human (GRCh38) Human (GRCh38)
Location 6:69990888-69990910 6:69990940-69990962
Sequence CCTTTTTCTGACTTCTATTTTAG ATGAGTAAATTGTGTGTCACAGG
Strand - +
Off-target summary No data {0: 8, 1: 57, 2: 169, 3: 421, 4: 835}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!