ID: 1009935296_1009935304

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1009935296 1009935304
Species Human (GRCh38) Human (GRCh38)
Location 6:70227002-70227024 6:70227031-70227053
Sequence CCCAAAAAGTAGGCCCAAATACA ATTTGGGTTTATAATGAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!